Ttyjfyk

When an outsider describes family relationships, which point of view are they using?

Is there a math expression equivalent to the conditional ternary operator?

How exactly does an Ethernet collision happen in the cable, since nodes use different circuits for Tx and Rx?

What can I do if someone tampers with my SSH public key?

School performs periodic password audits. Is my password compromised?

Why aren't there more Gauls like Obelix?

Rationale to prefer local variables over instance variables?

Would those living in a "perfect society" not understand satire

What is better: yes / no radio, or simple checkbox?

Which country has more?

Translation of 答えを知っている人はいませんでした

Difference between `nmap local-IP-address` and `nmap localhost`

Traveling to heavily polluted city, what practical measures can I take to minimize impact?

Create chunks from an array

Was it really inappropriate to write a pull request for the company I interviewed with?

Converting from "matrix" data into "coordinate" data

Short scifi story where reproductive organs are converted to produce "materials", pregnant protagonist is "found fit" to be a mother

Either of .... (Plural/Singular)

Is divide-by-zero a security vulnerability?

(Codewars) Linked Lists-Sorted Insert

Can the Witch Sight warlock invocation see through the Mirror Image spell?

Locked Away- What am I?

Why restrict private health insurance?

The (Easy) Road to Code

tab separation of the file

awk manipulation of filechanging column separators in a fileExtracting lines based on conditionsAdd a space or tab before the last character in each lineRemove lines from tab-delimited file with missing valuesPrint lines not containing a TabMerging two files, one column at a timePrint if for the same 1st field there's a single value of 2nd field on all linessed to search for tabCombine list of words into one line, then add charactersextracting information from a column

3

I have a file with seq likes this

ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT
ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC
ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT

It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.

text-processing sed awk

share|improve this question

edited 18 mins ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373user3138373

89041630

• 
  
  
  

  
  2
  

  
  
  
  
  
  

  
  
  With such questions you should always give an example for the expected output.
  
  – Hauke Laging
  Dec 17 '14 at 22:41
  

  
  
  
  


• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.
  
  – eyoung100
  Dec 17 '14 at 23:05
  
  

  
  
  
  

add a comment | 

3

I have a file with seq likes this

ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT
ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC
ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT

It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.

text-processing sed awk

share|improve this question

edited 18 mins ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373user3138373

89041630

• 
  
  
  

  
  2
  

  
  
  
  
  
  

  
  
  With such questions you should always give an example for the expected output.
  
  – Hauke Laging
  Dec 17 '14 at 22:41
  

  
  
  
  


• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.
  
  – eyoung100
  Dec 17 '14 at 23:05
  
  

  
  
  
  

add a comment | 

I have a file with seq likes this

ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT
ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC
ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT

It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.

text-processing sed awk

share|improve this question

edited 18 mins ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373user3138373

89041630

ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT
ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC
ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT

share|improve this question

edited 18 mins ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373user3138373

89041630

share|improve this question

edited 18 mins ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373user3138373

89041630

edited 18 mins ago

Rui F Ribeiro

41.3k1481140

edited 18 mins ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373user3138373

89041630

asked Dec 17 '14 at 22:38

user3138373user3138373

89041630

4 Answers
4

active

oldest

votes

5

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

share|improve this answer

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke LagingHauke Laging

57.2k1287135

add a comment | 

2

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

share|improve this answer

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles QuenotGilles Quenot

16.3k14053

• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  If you like golf: perl -ne '$,="t";print split//' file > new_file
  
  – Joseph R.
  Dec 18 '14 at 5:00
  

  
  
  
  

add a comment | 

2

In awk:

awk -F '' -vOFS='t' '$1=$11' file > new_file

Borrowed the idiom $1=$11 from an answer to one of your other questions.

This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.

share|improve this answer

edited Apr 13 '17 at 12:36

Community♦

1

answered Dec 18 '14 at 4:49

Joseph R.Joseph R.

28.6k375116

• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.
  
  – mikeserv
  Dec 18 '14 at 4:52
  
  

  
  
  
  


• 
  
  
  

  
  1
  

  
  
  
  
  
  

  
  
  @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)
  
  – Joseph R.
  Dec 18 '14 at 4:53
  

  
  
  
  


• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.
  
  – mikeserv
  Dec 18 '14 at 4:56
  
  

  
  
  
  


• 
  
  
  

  
  1
  

  
  
  
  
  
  

  
  
  @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.
  
  – Joseph R.
  Dec 18 '14 at 4:58
  

  
  
  
  

add a comment | 

1

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile

I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.

share|improve this answer

answered Dec 18 '14 at 3:41

mikeservmikeserv

45.8k668160

add a comment | 

Your Answer

StackExchange.ready(function()
var channelOptions =
tags: "".split(" "),
id: "106"
;
initTagRenderer("".split(" "), "".split(" "), channelOptions);

StackExchange.using("externalEditor", function()
// Have to fire editor after snippets, if snippets enabled
if (StackExchange.settings.snippets.snippetsEnabled)
StackExchange.using("snippets", function()
createEditor();
);

else
createEditor();

);

function createEditor()
StackExchange.prepareEditor(
heartbeatType: 'answer',
autoActivateHeartbeat: false,
convertImagesToLinks: false,
noModals: true,
showLowRepImageUploadWarning: true,
reputationToPostImages: null,
bindNavPrevention: true,
postfix: "",
imageUploader:
brandingHtml: "Powered by u003ca class="icon-imgur-white" href="https://imgur.com/"u003eu003c/au003e",
contentPolicyHtml: "User contributions licensed under u003ca href="https://creativecommons.org/licenses/by-sa/3.0/"u003ecc by-sa 3.0 with attribution requiredu003c/au003e u003ca href="https://stackoverflow.com/legal/content-policy"u003e(content policy)u003c/au003e",
allowUrls: true
,
onDemand: true,
discardSelector: ".discard-answer"
,immediatelyShowMarkdownHelp:true
);



);

draft saved

draft discarded

Sign up or log in

StackExchange.ready(function ()
StackExchange.helpers.onClickDraftSave('#login-link');
);

Sign up using Google

Sign up using Facebook

Sign up using Email and Password

Post as a guest

Name

Email

Required, but never shown

StackExchange.ready(
function ()
StackExchange.openid.initPostLogin('.new-post-login', 'https%3a%2f%2funix.stackexchange.com%2fquestions%2f174755%2ftab-separation-of-the-file%23new-answer', 'question_page');

);

Post as a guest

Name

Email

Required, but never shown

5

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

share|improve this answer

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke LagingHauke Laging

57.2k1287135

add a comment | 

5

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

share|improve this answer

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke LagingHauke Laging

57.2k1287135

add a comment | 

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

share|improve this answer

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke LagingHauke Laging

57.2k1287135

sed -e 's/./&t/g' -e $'s/t$//' file

share|improve this answer

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke LagingHauke Laging

57.2k1287135

answered Dec 17 '14 at 22:41

Hauke LagingHauke Laging

57.2k1287135

answered Dec 17 '14 at 22:41

Hauke LagingHauke Laging

57.2k1287135

2

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

share|improve this answer

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles QuenotGilles Quenot

16.3k14053

• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  If you like golf: perl -ne '$,="t";print split//' file > new_file
  
  – Joseph R.
  Dec 18 '14 at 5:00
  

  
  
  
  

add a comment | 

2

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

share|improve this answer

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles QuenotGilles Quenot

16.3k14053

• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  If you like golf: perl -ne '$,="t";print split//' file > new_file
  
  – Joseph R.
  Dec 18 '14 at 5:00
  

  
  
  
  

add a comment | 

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

share|improve this answer

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles QuenotGilles Quenot

16.3k14053

perl -ne 'print join "t", split //' file > new_file

share|improve this answer

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles QuenotGilles Quenot

16.3k14053

answered Dec 17 '14 at 22:41

Gilles QuenotGilles Quenot

16.3k14053

answered Dec 17 '14 at 22:41

Gilles QuenotGilles Quenot

16.3k14053

2

In awk:

awk -F '' -vOFS='t' '$1=$11' file > new_file

Borrowed the idiom $1=$11 from an answer to one of your other questions.

This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.

share|improve this answer

edited Apr 13 '17 at 12:36

Community♦

1

answered Dec 18 '14 at 4:49

Joseph R.Joseph R.

28.6k375116

• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.
  
  – mikeserv
  Dec 18 '14 at 4:52
  
  

  
  
  
  


• 
  
  
  

  
  1
  

  
  
  
  
  
  

  
  
  @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)
  
  – Joseph R.
  Dec 18 '14 at 4:53
  

  
  
  
  


• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.
  
  – mikeserv
  Dec 18 '14 at 4:56
  
  

  
  
  
  


• 
  
  
  

  
  1
  

  
  
  
  
  
  

  
  
  @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.
  
  – Joseph R.
  Dec 18 '14 at 4:58
  

  
  
  
  

add a comment | 

2

In awk:

awk -F '' -vOFS='t' '$1=$11' file > new_file

Borrowed the idiom $1=$11 from an answer to one of your other questions.

This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.

share|improve this answer

edited Apr 13 '17 at 12:36

Community♦

1

answered Dec 18 '14 at 4:49

Joseph R.Joseph R.

28.6k375116

• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.
  
  – mikeserv
  Dec 18 '14 at 4:52
  
  

  
  
  
  


• 
  
  
  

  
  1
  

  
  
  
  
  
  

  
  
  @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)
  
  – Joseph R.
  Dec 18 '14 at 4:53
  

  
  
  
  


• 
  
  
  

  
  

  
  
  
  
  
  

  
  
  I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.
  
  – mikeserv
  Dec 18 '14 at 4:56
  
  

  
  
  
  


• 
  
  
  

  
  1
  

  
  
  
  
  
  

  
  
  @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.
  
  – Joseph R.
  Dec 18 '14 at 4:58
  

  
  
  
  

add a comment | 

In awk:

awk -F '' -vOFS='t' '$1=$11' file > new_file

Borrowed the idiom $1=$11 from an answer to one of your other questions.

This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.

share|improve this answer

edited Apr 13 '17 at 12:36

Community♦

1

answered Dec 18 '14 at 4:49

Joseph R.Joseph R.

28.6k375116

awk -F '' -vOFS='t' '$1=$11' file > new_file

share|improve this answer

edited Apr 13 '17 at 12:36

Community♦

1

answered Dec 18 '14 at 4:49

Joseph R.Joseph R.

28.6k375116

edited Apr 13 '17 at 12:36

Community♦

1

edited Apr 13 '17 at 12:36

Community♦

1

answered Dec 18 '14 at 4:49

Joseph R.Joseph R.

28.6k375116

answered Dec 18 '14 at 4:49

Joseph R.Joseph R.

28.6k375116

1

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile

I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.

share|improve this answer

answered Dec 18 '14 at 3:41

mikeservmikeserv

45.8k668160

add a comment | 

1

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile

I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.

share|improve this answer

answered Dec 18 '14 at 3:41

mikeservmikeserv

45.8k668160

add a comment | 

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile

I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.

share|improve this answer

answered Dec 18 '14 at 3:41

mikeservmikeserv

45.8k668160

tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile

share|improve this answer

answered Dec 18 '14 at 3:41

mikeservmikeserv

45.8k668160

answered Dec 18 '14 at 3:41

mikeservmikeserv

45.8k668160

answered Dec 18 '14 at 3:41

mikeservmikeserv

45.8k668160