tab separation of the fileawk manipulation of filechanging column separators in a fileExtracting lines based on conditionsAdd a space or tab before the last character in each lineRemove lines from tab-delimited file with missing valuesPrint lines not containing a TabMerging two files, one column at a timePrint if for the same 1st field there's a single value of 2nd field on all linessed to search for tabCombine list of words into one line, then add charactersextracting information from a column

When an outsider describes family relationships, which point of view are they using?

Is there a math expression equivalent to the conditional ternary operator?

How exactly does an Ethernet collision happen in the cable, since nodes use different circuits for Tx and Rx?

What can I do if someone tampers with my SSH public key?

School performs periodic password audits. Is my password compromised?

Why aren't there more Gauls like Obelix?

Rationale to prefer local variables over instance variables?

Would those living in a "perfect society" not understand satire

What is better: yes / no radio, or simple checkbox?

Which country has more?

Translation of 答えを知っている人はいませんでした

Difference between `nmap local-IP-address` and `nmap localhost`

Traveling to heavily polluted city, what practical measures can I take to minimize impact?

Create chunks from an array

Was it really inappropriate to write a pull request for the company I interviewed with?

Converting from "matrix" data into "coordinate" data

Short scifi story where reproductive organs are converted to produce "materials", pregnant protagonist is "found fit" to be a mother

Either of .... (Plural/Singular)

Is divide-by-zero a security vulnerability?

(Codewars) Linked Lists-Sorted Insert

Can the Witch Sight warlock invocation see through the Mirror Image spell?

Locked Away- What am I?

Why restrict private health insurance?

The (Easy) Road to Code



tab separation of the file


awk manipulation of filechanging column separators in a fileExtracting lines based on conditionsAdd a space or tab before the last character in each lineRemove lines from tab-delimited file with missing valuesPrint lines not containing a TabMerging two files, one column at a timePrint if for the same 1st field there's a single value of 2nd field on all linessed to search for tabCombine list of words into one line, then add charactersextracting information from a column













3















I have a file with seq likes this



ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT
ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC
ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT


It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.










share|improve this question



















  • 2





    With such questions you should always give an example for the expected output.

    – Hauke Laging
    Dec 17 '14 at 22:41











  • It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

    – eyoung100
    Dec 17 '14 at 23:05
















3















I have a file with seq likes this



ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT
ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC
ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT


It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.










share|improve this question



















  • 2





    With such questions you should always give an example for the expected output.

    – Hauke Laging
    Dec 17 '14 at 22:41











  • It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

    – eyoung100
    Dec 17 '14 at 23:05














3












3








3








I have a file with seq likes this



ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT
ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC
ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT


It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.










share|improve this question
















I have a file with seq likes this



ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT
ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC
ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT


It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.







text-processing sed awk






share|improve this question















share|improve this question













share|improve this question




share|improve this question








edited 18 mins ago









Rui F Ribeiro

41.3k1481140




41.3k1481140










asked Dec 17 '14 at 22:38









user3138373user3138373

89041630




89041630







  • 2





    With such questions you should always give an example for the expected output.

    – Hauke Laging
    Dec 17 '14 at 22:41











  • It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

    – eyoung100
    Dec 17 '14 at 23:05













  • 2





    With such questions you should always give an example for the expected output.

    – Hauke Laging
    Dec 17 '14 at 22:41











  • It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

    – eyoung100
    Dec 17 '14 at 23:05








2




2





With such questions you should always give an example for the expected output.

– Hauke Laging
Dec 17 '14 at 22:41





With such questions you should always give an example for the expected output.

– Hauke Laging
Dec 17 '14 at 22:41













It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

– eyoung100
Dec 17 '14 at 23:05






It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

– eyoung100
Dec 17 '14 at 23:05











4 Answers
4






active

oldest

votes


















5














If I have understood your intention correctly then this does it:



sed -e 's/./&t/g' -e $'s/t$//' file


The second replacement deletes the tab at the end of the line.






share|improve this answer
































    2














    Try doing this using perl:



    perl -ne 'print join "t", split //' file > new_file





    share|improve this answer

























    • If you like golf: perl -ne '$,="t";print split//' file > new_file

      – Joseph R.
      Dec 18 '14 at 5:00


















    2














    In awk:



    awk -F '' -vOFS='t' '$1=$11' file > new_file


    Borrowed the idiom $1=$11 from an answer to one of your other questions.



    This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.






    share|improve this answer

























    • pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

      – mikeserv
      Dec 18 '14 at 4:52







    • 1





      @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

      – Joseph R.
      Dec 18 '14 at 4:53











    • I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

      – mikeserv
      Dec 18 '14 at 4:56







    • 1





      @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

      – Joseph R.
      Dec 18 '14 at 4:58


















    1














    I think you should give fold a go:



    tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile


    I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.






    share|improve this answer






















      Your Answer








      StackExchange.ready(function()
      var channelOptions =
      tags: "".split(" "),
      id: "106"
      ;
      initTagRenderer("".split(" "), "".split(" "), channelOptions);

      StackExchange.using("externalEditor", function()
      // Have to fire editor after snippets, if snippets enabled
      if (StackExchange.settings.snippets.snippetsEnabled)
      StackExchange.using("snippets", function()
      createEditor();
      );

      else
      createEditor();

      );

      function createEditor()
      StackExchange.prepareEditor(
      heartbeatType: 'answer',
      autoActivateHeartbeat: false,
      convertImagesToLinks: false,
      noModals: true,
      showLowRepImageUploadWarning: true,
      reputationToPostImages: null,
      bindNavPrevention: true,
      postfix: "",
      imageUploader:
      brandingHtml: "Powered by u003ca class="icon-imgur-white" href="https://imgur.com/"u003eu003c/au003e",
      contentPolicyHtml: "User contributions licensed under u003ca href="https://creativecommons.org/licenses/by-sa/3.0/"u003ecc by-sa 3.0 with attribution requiredu003c/au003e u003ca href="https://stackoverflow.com/legal/content-policy"u003e(content policy)u003c/au003e",
      allowUrls: true
      ,
      onDemand: true,
      discardSelector: ".discard-answer"
      ,immediatelyShowMarkdownHelp:true
      );



      );













      draft saved

      draft discarded


















      StackExchange.ready(
      function ()
      StackExchange.openid.initPostLogin('.new-post-login', 'https%3a%2f%2funix.stackexchange.com%2fquestions%2f174755%2ftab-separation-of-the-file%23new-answer', 'question_page');

      );

      Post as a guest















      Required, but never shown

























      4 Answers
      4






      active

      oldest

      votes








      4 Answers
      4






      active

      oldest

      votes









      active

      oldest

      votes






      active

      oldest

      votes









      5














      If I have understood your intention correctly then this does it:



      sed -e 's/./&t/g' -e $'s/t$//' file


      The second replacement deletes the tab at the end of the line.






      share|improve this answer





























        5














        If I have understood your intention correctly then this does it:



        sed -e 's/./&t/g' -e $'s/t$//' file


        The second replacement deletes the tab at the end of the line.






        share|improve this answer



























          5












          5








          5







          If I have understood your intention correctly then this does it:



          sed -e 's/./&t/g' -e $'s/t$//' file


          The second replacement deletes the tab at the end of the line.






          share|improve this answer















          If I have understood your intention correctly then this does it:



          sed -e 's/./&t/g' -e $'s/t$//' file


          The second replacement deletes the tab at the end of the line.







          share|improve this answer














          share|improve this answer



          share|improve this answer








          edited Dec 18 '14 at 0:40

























          answered Dec 17 '14 at 22:41









          Hauke LagingHauke Laging

          57.2k1287135




          57.2k1287135























              2














              Try doing this using perl:



              perl -ne 'print join "t", split //' file > new_file





              share|improve this answer

























              • If you like golf: perl -ne '$,="t";print split//' file > new_file

                – Joseph R.
                Dec 18 '14 at 5:00















              2














              Try doing this using perl:



              perl -ne 'print join "t", split //' file > new_file





              share|improve this answer

























              • If you like golf: perl -ne '$,="t";print split//' file > new_file

                – Joseph R.
                Dec 18 '14 at 5:00













              2












              2








              2







              Try doing this using perl:



              perl -ne 'print join "t", split //' file > new_file





              share|improve this answer















              Try doing this using perl:



              perl -ne 'print join "t", split //' file > new_file






              share|improve this answer














              share|improve this answer



              share|improve this answer








              edited Dec 17 '14 at 22:48

























              answered Dec 17 '14 at 22:41









              Gilles QuenotGilles Quenot

              16.3k14053




              16.3k14053












              • If you like golf: perl -ne '$,="t";print split//' file > new_file

                – Joseph R.
                Dec 18 '14 at 5:00

















              • If you like golf: perl -ne '$,="t";print split//' file > new_file

                – Joseph R.
                Dec 18 '14 at 5:00
















              If you like golf: perl -ne '$,="t";print split//' file > new_file

              – Joseph R.
              Dec 18 '14 at 5:00





              If you like golf: perl -ne '$,="t";print split//' file > new_file

              – Joseph R.
              Dec 18 '14 at 5:00











              2














              In awk:



              awk -F '' -vOFS='t' '$1=$11' file > new_file


              Borrowed the idiom $1=$11 from an answer to one of your other questions.



              This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.






              share|improve this answer

























              • pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

                – mikeserv
                Dec 18 '14 at 4:52







              • 1





                @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

                – Joseph R.
                Dec 18 '14 at 4:53











              • I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

                – mikeserv
                Dec 18 '14 at 4:56







              • 1





                @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

                – Joseph R.
                Dec 18 '14 at 4:58















              2














              In awk:



              awk -F '' -vOFS='t' '$1=$11' file > new_file


              Borrowed the idiom $1=$11 from an answer to one of your other questions.



              This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.






              share|improve this answer

























              • pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

                – mikeserv
                Dec 18 '14 at 4:52







              • 1





                @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

                – Joseph R.
                Dec 18 '14 at 4:53











              • I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

                – mikeserv
                Dec 18 '14 at 4:56







              • 1





                @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

                – Joseph R.
                Dec 18 '14 at 4:58













              2












              2








              2







              In awk:



              awk -F '' -vOFS='t' '$1=$11' file > new_file


              Borrowed the idiom $1=$11 from an answer to one of your other questions.



              This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.






              share|improve this answer















              In awk:



              awk -F '' -vOFS='t' '$1=$11' file > new_file


              Borrowed the idiom $1=$11 from an answer to one of your other questions.



              This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom $1=$11 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.







              share|improve this answer














              share|improve this answer



              share|improve this answer








              edited Apr 13 '17 at 12:36









              Community

              1




              1










              answered Dec 18 '14 at 4:49









              Joseph R.Joseph R.

              28.6k375116




              28.6k375116












              • pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

                – mikeserv
                Dec 18 '14 at 4:52







              • 1





                @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

                – Joseph R.
                Dec 18 '14 at 4:53











              • I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

                – mikeserv
                Dec 18 '14 at 4:56







              • 1





                @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

                – Joseph R.
                Dec 18 '14 at 4:58

















              • pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

                – mikeserv
                Dec 18 '14 at 4:52







              • 1





                @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

                – Joseph R.
                Dec 18 '14 at 4:53











              • I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

                – mikeserv
                Dec 18 '14 at 4:56







              • 1





                @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

                – Joseph R.
                Dec 18 '14 at 4:58
















              pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

              – mikeserv
              Dec 18 '14 at 4:52






              pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

              – mikeserv
              Dec 18 '14 at 4:52





              1




              1





              @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

              – Joseph R.
              Dec 18 '14 at 4:53





              @mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

              – Joseph R.
              Dec 18 '14 at 4:53













              I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

              – mikeserv
              Dec 18 '14 at 4:56






              I wonder if that $1=$11 thing is anything like sed's s/.0,1/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

              – mikeserv
              Dec 18 '14 at 4:56





              1




              1





              @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

              – Joseph R.
              Dec 18 '14 at 4:58





              @mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

              – Joseph R.
              Dec 18 '14 at 4:58











              1














              I think you should give fold a go:



              tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile


              I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.






              share|improve this answer



























                1














                I think you should give fold a go:



                tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile


                I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.






                share|improve this answer

























                  1












                  1








                  1







                  I think you should give fold a go:



                  tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile


                  I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.






                  share|improve this answer













                  I think you should give fold a go:



                  tr \n \r <infile | fold -w1 | tr 'rn' 'nt' >outfile


                  I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.







                  share|improve this answer












                  share|improve this answer



                  share|improve this answer










                  answered Dec 18 '14 at 3:41









                  mikeservmikeserv

                  45.8k668160




                  45.8k668160



























                      draft saved

                      draft discarded
















































                      Thanks for contributing an answer to Unix & Linux Stack Exchange!


                      • Please be sure to answer the question. Provide details and share your research!

                      But avoid


                      • Asking for help, clarification, or responding to other answers.

                      • Making statements based on opinion; back them up with references or personal experience.

                      To learn more, see our tips on writing great answers.




                      draft saved


                      draft discarded














                      StackExchange.ready(
                      function ()
                      StackExchange.openid.initPostLogin('.new-post-login', 'https%3a%2f%2funix.stackexchange.com%2fquestions%2f174755%2ftab-separation-of-the-file%23new-answer', 'question_page');

                      );

                      Post as a guest















                      Required, but never shown





















































                      Required, but never shown














                      Required, but never shown












                      Required, but never shown







                      Required, but never shown

































                      Required, but never shown














                      Required, but never shown












                      Required, but never shown







                      Required, but never shown







                      Popular posts from this blog

                      Can I sign legal documents with a smiley face?Do Legal Documents Require Signing In Standard Pen Colors?Is it possible to legally prohibit someone from linking to specific pages on your website?Do scans of signed documents have the same legal power as the original document?What can I do if I signed an excessively restrictive contract?Can other party sneak in new contract terms via termination notice?How to prove that someone forged my signature on a contract that I was not aware of?In Australia, Is it legal to sign a document as somebody else?making a contract that includes video licenceLease dispute, over email and text messageIf you must include all of the natural language prose in a legal document, or if it can be abstracted outE-signing: legal ramifications of “identifying” a person

                      Word for a person who has no opinion about whether god existsWord for having a definite opinion while simultaneously withholding judgment?What's the opposite of “newcomer? Is ”veteran" OK?What do you call an “atheist” who might believe in an afterlife?What's a word for someone who wants to voice opinions but not have them challenged?Word for someone who dismisses contrary opinions as irrational?Somone who thinks they are overly special/out of the ordinaryIs there a word, phrase or idiom for “a person who is incapable of thinking about the future”?The belief that a god is human-likeA word for a non-famous person/thing you have heard a lot aboutAdjective for a person who enjoys taking care of their appearance

                      Can I redirect output to a log file and background a process at the same time?2019 Community Moderator ElectionUnable to write to file in shell script when running command in backgroundredirect and log script outputhow to properly log the output of a console program that frequently updates “parts” of the screen, resulting in a messy log file?How can I redirect the output of a child process?grep script - output lines at the same time into echoHow to run process in background and get its pid to create log file nameHow to redirect output to a log from expect commandHow to clear a redirect log file content in shell?Log background jobs started in all the manually started shells?Why do `jobs` and `dirs` run in command subsitution, process substitution, pipeline, and background jobs output the same as in original shell?How to redirect output to file to STDOUT?